Detail the locations and fate of a glucose molecule in a French fry from the time you swallow it until it gets turned into CO2 and water in the mitochondria of a muscle cell in the lower leg.
Then discuss the locations and fate of the CO2 and water molecules as they leave the mitochondria until they eventually leave the body.

Answers

Answer 1

Answer: the glucose is a weird circle thing and a french fry is a food.

Explanation: not really understanding the question here...


Related Questions

if the dna sequence is TAC CCC AAG CTC GGT ATC. what is mRNA

tRNA

AA?

Answers

The mRNA sequence would be:

AUG GGG UUC GAG CCA UAG

The mRNA sequence is complementary to the DNA sequence, in other words would just basically mean you do the opposite of the bases to the DNA sequence such that:

Cytosine with Guanine

Thymine (uracil for RNA) with Adenine

However, mRNA has Uracil instead of Thymine, so instead the uracil in mRNA binds with adenine.

Urcacil with Adenine

For tRNA, they have anticodons, meaning they have bases complementary to the mRNA strand, so the tRNA with the complementary anticodon sequence would be:

UAC CCC AAG CUC GGU AUC (DNA sequence but replace thymine with uracil)

For the amino acids, they would bond to the specific tRNA molecules with the specific bases on the anticodons.

Which instruments has indefinite pitch

Answers

Instruments of indefinite pitch exist by the hundreds. Some of the more common ones are the snare drum, tenor drum, tom-tom, bass drum, bongos,

10. If the red allele is incompletely dominant to the white alle
individual's phenotype be?

Answers

If RR Is red, and rr is white, Rr is pink. Incomplete dominance is a mixing of traits.

Whatcha are the three cells of the cells theory

Answers

Answer:

2 and 3 are the other ones

Explanation:

4. Which of these is a terrestrial plant? A. green algae B. duckweeds C. white gourd D. Yellow lily 5. Where does a plant with thick stem for storing water probably grow? A. desert B. mountains. C. forest D. ocean 6. Which of these is a function of waxy leaves in a plant? A. roof of the plant C. protects the plant from animals B. absorb nutrients from the soil D. protect the plant from dehydration
PLEASE HELP ME I REALLY NEED THE CORRECT ANSWER RIGHT NOW!!!!​

Answers

Answer:

first one is the lily

Explanation:

Examine the food web below. Suppose the local government sprayed a pesticide to kill mosquitoes. The sparrows ate the poisoned mosquitoes and died as well. What would most likely happen to the organisms in this food chain after the sparrows began to disappear?
A.
There would be an overpopulation of caterpillars, which would threaten the oak trees.
B.
The sparrows’ disappearance would not affect the other organisms in the ecosystem.
C.
Most of the organisms in the ecosystem would starve and die.
D.
The eagle would loose its primary food source and be forced to start feeding on mountain lions.

Answers

Answer:

A. There would be an overpopulation of caterpillars, which would threaten the oak trees

Explanation:

Because sparrows eat caterpillars as a primary food source, when the population of sparrows decrease, the population of caterpillars will increase. Because of this, more caterpillars will be feeding off of the oak trees, therefore threatening the oak trees. I hope this helps!

Need answers for this
Thanks

Answers

Answer:

IT is going to be the color purple since there is no sunlight hitting tube A which means no carbon dioxide

Explanation:

What stage of cell respiration is being shown above?

Answers

The stage of cell respiration that is being shown above is oxidative phosphorylation. During this stage, the transport of electrons is coupled to the generation of an electrochemical gradient.

Cellular respiration can be defined as a series of metabolic reactions by which aerobic cells generate energy in the form of ATP.

Cellular respiration has three main stages: glycolysis, the Krebs cycle and oxidative phosphorylation.

During oxidative phosphorylation, the transport of electrons across the mitochondrial membrane is coupled to the generation of an electrochemical gradient, which is then used to generate ATP by an ATP synthase as shown in the figure.

Learn more about ATP synthases here:

https://brainly.com/question/893601

which is not a topic of biology?
a. the distribution of sand on an ocean floor
b. the chemicals at work in the stomach
c. the speed at which a hummingbird flies

Answers

a. the distribution of sand on an ocean floor
C. The speed at which a hummingbird flies


In order for mutations to be passed to offspring in sexually reproducing organisms, the
mutation(s) must occur in sex cells. Why is this NOT true for bacteria like Staphylococcus?
Choose one or more:

Answers

Answer:

Bacteria can evolve quickly because they reproduce at a fast rate. Mutations in the DNA of bacteria can produce new characteristics and that the bacterium will grow better than its neighbors and can increase in numbers..

Explanation:

N/A

Humans pump water out of the aquifers in the ground to use in their homes. How would this effect the land on top of the aquifer?

Answers

When too much water is pumped out of an aquifer, you can make a sink hole above it, as there is now air/empty space where water used to be.

If you cross two organisms that are heterozygous for a trait, what percent of
the offspring would you expect to express the recessive phenotype?

Answers

Answer:

25%

Explanation:

Here's an example: two chickens have the phenotype of white feathers and brown feathers. What percentage of the chicks will have the recessive color? First, you have to see the parents' phenotypes. Draw a punnet square. Put one of the parent's phenotypes (w and B) on the top, and the other parent's (w and B) on the right side going down. Whichever trait is dominant (brown) MUST be capitalized. Then, cross the two parents. first box on the top left would read 'ww.' The one below it is 'Bw' (put the dominant first). The right top is 'Bw' and the one below it is 'BB'. So if there were 4 offspring, these would be their genotypes: 'ww', 'Bw', 'Bw', and 'BB'. The only offspring that would have the recessive trait is the 'ww' child, because dominant overpowers recessive. So 25% would have the recessive trait and 75% would have the dominant trait.

Abagnale's life could best be paraphrased as...​

Answers

Answer:

running from the law and later working for  the law.

Explanation:

Frank Abagnale Jr. is the clear example of a boy who makes mistakes when trying to progress quickly without caring about his crimes, among which are the falsification of documents and checks, as well as the illegal practice of professions, which is why which during his youth had to flee from justice, however, due to the expertise he obtained after creating many false checks and his criminal journey, the American government gave him the possibility of working with them, contributing his knowledge of possible techniques fraud and help counter it, which was paradoxical considering his background.

Explain how natural disasters can change the characteristics of a species for many generations after the disaster. To develop this discussion you will need a minimum of 2 paragraphs.

Answers

Answer:

Strong volcanic eruptions and fires can temporarily change regional weather, cooling or heating the air, changing winds, or causing rain. Volcanoes, storms, and floods can kill marine animals directly, or cause long-term problems by depositing debris and affecting the temperature and salinity of water.

Natural disaster especially such as forest fires and hurricanes have the potential to threaten these endangered species to the point of extinction. ... The fires destroy the animals habitats including their homes, nesting grounds, food, and winter shelters.

After a natural disaster, the community will often go through ecological succession and return to the state it was pre-diaster. Healthy ecosystems will bounce back, as natural disasters have occurred on earth for a long time. ... Healthy ecosystems are adapted to withstand natural disasters over the long time.

Part C
Now, set the mass of both balls to be equal. Increase the distance between them by pulling one of
the balls away from the other. To pull a ball away, click on the ball and drag it. What happens to
the force arrows between the two balls? What does this mean in terms of gravity?
B

I u X X
Font Sizes
A, A E
Characters used: 0/ 15000
Submit

Answers

Answer: law of motion

Explanation:

Newton’s first two laws of motion explain how the motion of a single object changes. If the forces acting on the object are bal- anced, the object will remain at rest or stay in motion with con- stant velocity. If the forces are unbalanced, the object will accelerate in the direction of the net force. Newton’s second law tells how to calculate the acceleration, or change in motion, of an object if the net force acting on it is known.

Newton’s third law describes something else that happens when one object exerts a force on another object. Suppose you push on a wall. It may surprise you to learn that if you push on a wall, the wall also pushes on you. According to Newton’s third law of motion,

Granite is an intrusive igneous rock with large crystals because it cools slowly. Where was this rock most likely formed ?

A - in a river
B - deep inside a volcano
C- in a mountain range
D- on the surface of a volcano

Ik the answer is not c
Can someone help me figure this out plz and thank you

Answers

Answer: D

Explanation: Because rock cools on the surface of the volcano and I know because I learned about volcanoes and I went through the topic.

Granite is an intrusive igneous rock with large crystals because it cools slowly. this rock most likely formed on the surface of a volcano. thus option D is correct.

What is rock cycle ?

Rocks are naturally occurred on non-living earth which are made by collection of  mineral grains held together in a firm, it can be tiny or big as well and can be easily identified with their texture.

The Rock cycle can be defined as a continuous process through which old rocks are transformed into new rock due to cool down of molten magma, when it solidifies become igneous rock.

In a rock cycle, when the break down of these igneous rocks occur  small particles that are transported and deposited to form sedimentary rocks,  When the igneous and sedimentary rocks heated up and under the pressure they change into metamorphic rocks.

The metamorphic rocks which are subjected under great heat and pressure melt down to form molten magma which again can cool down and solidify into igneous rocks

For more details regarding rock, visit

brainly.com/question/9243222

#SPJ2

ASAP plz
Describe hurricanes and explain how these storms affect human behavior?

Answers

When a hurricane strikes a community, it leaves an
obvious path of destruction. As a result of high winds
and water from a storm surge, homes, businesses, and
crops may be destroyed or damaged, public
infrastructure may also be compromised, and people
may suffer injuries or loss of life.

Crabgrass, also known as digitaria sanguinalis, is a stationary multicellular species that belongs to kingdom Plantae. According to the table below which of the following species is most closely related to digitaria sanguinalis?

Answers

Answer:

Quercus

Explanation:

Ayúdenme plssssss y les doy puntos

Answers

Answer:

plato b

Explanation:

Answer:

photosynthesis converts the glucose that is made by cellular respiration to carbon dioxide

Which of the following are functions of an animal's movement structures like wings, legs, or fins? Select the two correct
answers. (1 point)
identifying food
keeping out bacteria and viruses
migrating to mating spots
o escaping from predators
protection from elements

Answers

The legs, wings, or fins most of the time are used in locomotion and sometimes in defense.

These are two functions of an animal's movement structures like wings, legs, or fins:

migrating to mating spots escaping from predators.

These structures are like structural adaptation defenses. These structures might be for defense, movement and for obtaining resources which might include food.

Learn more about these structural adaptations: https://brainly.com/question/352589

Answer:

migrating and escaping predators

Explanation:

What is Not a correct statement about chromosomes,Dna,or genes

Image below

Answers

A. Genes have the code that make protein

Which group of elements is provided by air and water?

Answers

Answer: Over 95 percent of the dry weight of a flowering plant is made up of three elements—carbon, hydrogen, and oxygen—taken from the air and water. The remaining 5 percent of the dry weight comes from chemicals absorbed from the soil.

Explanation:

If all mammals today evolved in 65 millions years from a common ancestor, and if one species took 100,000 years to evolve, how many ticks would tjis be?

Answers

Answer:

650

Explanation:

A recombinant plasmid molecule is introduced into a bacterial cell by A. recombination B. nuclear transplantation C. ligation D. transformation

Answers

D. Transformation

I’m in the same area of biology currently.

b) Give an example of an animal with radial symmetry and an example of an animal with bilateral
symmetry. (2 points)

Answers

Answer:jellyfishes, corals, anemones, and ctenophora.

Explanation:

Examples of animals that possess bilateral symmetry are: flatworms, common worms ("ribbon worms"), clams, snails, octopuses, crustaceans, insects, spiders, brachiopods, sea stars, sea urchins, and vertebrates.

Where does meiosis occur in male and female?

Answers

Testes in males and ovaries in females
Regarding the human reproduction process, the meiosis occurs in the seminiferous tubules of the testes of the males, whereas the process takes place in oogonia cells of the females. In males, the meiosis significantly takes place at puberty, whereas in females, it takes place at the time of birth.

Plzzzzz help
After conducting the experiment and reviewing the data, a marine biologist states that sea
turtles nest from May to October and determines that August is the most critical month. This is
an example of which step in the Scientific Method?
A. analyze the results
B. conduct the experiment
C. form a conclusion
D. form a hypothesis

Answers

The scientific method includes the problem statement, previous knowledge, hypothesis and goals, methodology, results, and discusion/conclusion. The correct option is C.  form a conclusion.

----------------

The scientific method is a research method that consists of systematic observations, measures, experimentation, analysis, and verification of a hypothesis. It is based on reproducibility and refutability.  

When conducting an experiment, you need to consider,

Definition and problem statement. The question for which there is not an answer yet. A question the investigator wants to answer.

Theoretical framework. Antecedents from other investigations. Previous knowledge about the study object is always required for a better understanding.

The main goal of the study is basically what the investigator wants to find out.

Hypothesis formulation. The researcher makes a hypothesis to predict or make a conjecture -not verified and which requires corroboration- about what is going on or expected to happen.  

Identification of the study groups, involved variables -independent, dependent, and control-.

Methodology description. Steps needed to get data.

Results. It includes data statistical analysis. This step involves testing the observations.

Discussion and Conclusion, through which the hypothesis might be rejected or accepted.

In the exposed example, the researcher has already collected field data, and made analysis.

Probably, the marine biologist noticed, while analyzing the results, that turtles lay eggs from May to October. But there might have been a biotic or abiotic factor threatening the survival of the eggs during august.  

According to the analysis the researcher concluded that the nest season involves monthes between may and october, and august turns to be the most critical month for nesting.

The correct option is C.

-----------------------------------------------

You can learn more about Scientific Method at

https://brainly.com/question/7508826

How is it possible to find the
number of heterozygotes in a
sample population, given the
allele frequencies?

Answers

Explanation:

The frequency of heterozygous individuals. Answer: The frequency of heterozygous individuals is equal to 2pq. In this case, 2pq equals 0.32, which means that the frequency of individuals heterozygous for this gene is equal to 32% (i.e. 2 (0.8)(0.2) = 0.32

To find the number of heterozygotes in a sample population, we need to know the allele frequencies and the total number of individuals in the population. The formula used to calculate the expected number of heterozygotes in a population is based on the Hardy-Weinberg equilibrium principle.

The Hardy-Weinberg equation is given as:

p² + 2pq + q² = 1

Where:

p = frequency of one (dominant) allele

q = frequency of the other allele (recessive) allele

p² = expected frequency of homozygous dominant individuals

2pq = expected frequency of heterozygous individuals

q² = expected frequency of homozygous recessive individuals

To find the number of heterozygotes, we can multiply the expected frequency of heterozygotes (2pq) by the total population size. This will give us an estimate of the number of individuals in the population who are heterozygous for the specific gene of interest.

Learn more about Hardy-Weinberg equation in:

https://brainly.com/question/29776155

#SPJ2

What designs the shape and size of all animals that are multi-cellar and have a back-bone

Answers

Answer

Environmental pressures

Basically every animal adapts to pressures from their environment in different ways, causing them to have different shapes and sizes

Which sentence correctly uses commas to separate phrases? The cooking class will teach us how to, grill fish, bake a pie, and make ice cream the mouth test will include the one word problem, one pair one graph and 10 questions. I spend my free time reading books, watching tv, and playing video games. Staying for involves eating healthy foods, staying active and, sleeping well

Answers

Answer:

the first one

Explanation:

.

Other Questions
6. The California Tiger Salamander is an endangered species, which decreases at the rate of 4.6% per year in a habitat that currently has 60 of them. Write an exponential function and find how many California Tiger Salamanders will be left after 4 years.7. Factor and solve the following equation 2x2 + x - 21 = 0.8. Alvin throws the football to a receiver who jumps up to catch the ball. The height of the ball over time can be represented by the quadratic equation -4.9t2 + 7.5t + 1.8 = 2.1 . This equation is based on the acceleration of gravity -4.9 m/s2, the velocity of his pass is 7.5 m/s and releases the football at a height of 1.8 meters, and the height where the receiver catches the ball of 2.1 meters. Put the equation in standard form and then solve by using the quadratic equation.9. Examine the graph of f(x) and the table that contains values of g(x). Which function has a greater rate of change over the interval [0,2]? Explain your answer. Put these numbers in order from least to greatest.-12/40 -5 19/38 See the picture first, thank you.QUESTIONS::1. Does each graph represent a linear function? Why?2. What is the domain of the first graph? second graph?3. What is the range of the first graph? second graph? help pleas im super slow i hate science Which of the following occurrences is LEAST likely lead to the development of the human resource of a country? Kindly help out with this question! AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA y=6x-17 -12x+2y = -34 ?? While emptying the autoclave, the medical assistant notices that the wrapped instruments are damp. The medical assistant should Which phrase best describes what a soil horizon is? A the bottom layer of a soil profile B each layer of a soil profile C the place where two soil profiles meetD the place where a soil profile meets bedrock A wave has wavelength of 10 m and a speed of 340 m/s. What is the frequency of the wave?I need the Formula,Known,Substitute & Solve Answer with Units Welcome to Gboard clipboard, any text you copy will be saved here. help pls im having trouble understanding this question As world population grows and the ocean is called on to provide more and more resources, what can people do to be sure the resources are used sustainably? Developing a shared understanding through communication is complex because __________________.a.everyone interprets the world differentlyc.learning to communicate well is too difficultb.no one understands enough words to communicate effectivelyd.all of the abovePlease select the best answer from the choices providedABCD (Place in chronological order) PLEASE HELPLondon Company establishes JamestownMayflower CompactUS ConstitutionDeclaration of IndependenceWar of 18121st Continental CongressColumbus's first voyage to the IndiesLouisiana PurchaseRevolutionary War beginsWashington becomes 1st US President I NEED MORE HELP PLZZ a uniform thin rod of length l and mass m is allowed to rotate on a frictionless pin passing through one end. The rod is released from rest in the horizontal position. a.) What is the speed of the center of gravity when the rod reaches its lowest position? b.) What is the tangential speed of the lowest point of the rod when the rod reaches its lowest position? Which examples of propaganda are found in this passage? Select two options.Snowball is used as a scapegoat.Napoleon talks to the animals through Squealer.Squealer targets his message to emphasize plain folks.Squealer uses glittering generalities to describe Napoleons tactics.Napoleon uses name-calling to differentiate the pigs from the other animals. who were dev and ashamvav